Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circTRIM24 | |||
Gene | TRIM24 | Organism | Human |
Genome Locus | chr7:138203933-138255748:+ | Build | hg19 |
Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
DBLink | Link to database | PMID | 27484176 |
Experimental Method | |||
Sample Type | Tissues and Cell lines | Comparison | Four pairs of snap-frozen bladder carcinoma tissue and matched para-carcinoma tissue |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GGATATGATGGAAAGGCTTTTG ReverseAAACACTGGTCGCTGGCTG | Statistics | Fold Change : Downregulated,6.3227161 pvalue : p=0.0000122246 |
Citation | |||
Zhong, Z, Lv, M, Chen, J (2016). Screening differential circular RNA expression profiles reveals the regulatory role of circTCF25-miR-103a-3p/miR-107-CDK6 pathway in bladder carcinoma. Sci Rep, 6:30919. |